• Scientific reports · Jul 2017

    Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    • Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, and Steven G Newmaster.
    • Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, 100193, China.
    • Sci Rep. 2017 Jul 19; 7 (1): 5858.

    AbstractLonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

      Pubmed     Free full text   Copy Citation     Plaintext  

      Add institutional full text...

    Notes

     
    Knowledge, pearl, summary or comment to share?
    300 characters remaining
    help        
    You can also include formatting, links, images and footnotes in your notes
    • Simple formatting can be added to notes, such as *italics*, _underline_ or **bold**.
    • Superscript can be denoted by <sup>text</sup> and subscript <sub>text</sub>.
    • Numbered or bulleted lists can be created using either numbered lines 1. 2. 3., hyphens - or asterisks *.
    • Links can be included with: [my link to pubmed](http://pubmed.com)
    • Images can be included with: ![alt text](https://bestmedicaljournal.com/study_graph.jpg "Image Title Text")
    • For footnotes use [^1](This is a footnote.) inline.
    • Or use an inline reference [^1] to refer to a longer footnote elseweher in the document [^1]: This is a long footnote..

    hide…

What will the 'Medical Journal of You' look like?

Start your free 21 day trial now.

We guarantee your privacy. Your email address will not be shared.